Homework Help v1.3

[GiantMidget]

A proton moves perpendicularly to a magnetic field that has a magnitude of 4.74x10^-2T.
The charge on a proton is 1.60x10^-19.
What is the speed of the particle if the
magnitude of the magnetic force on it is 1.16x10^-14N?
Answer in units of m/s.

what formula do I use for this?

[ahme]

Originally Posted by GiantMidget

A proton moves perpendicularly to a magnetic field that has a magnitude of 4.74x10^-2T.
The charge on a proton is 1.60x10^-19.
What is the speed of the particle if the
magnitude of the magnetic force on it is 1.16x10^-14N?
Answer in units of m/s.

what formula do I use for this?

F = qv x B (where v x B is the cross product of v and B)

[Ice(v)an]

Anyone here with knowledge of JavaScript.

3) Set a value to the current seconds (both digits) based on the rundate.
Display this value in color, increment by 1 and display the new value on a new line in a NEW color. (i.e.; use the new value to determine a new color for the new line) Repeat until 10 values have been displayed.

is this right?
Also, how do I add colors to the seconds text, and have it change each time.

<script type="text/javascript">
<!--Hide from non-JavaScript browsers

var new Sec("seconds");

function ShowSec(seconds) {
document.write("Seconds as of now is:" + seconds + "<br />");

DateObject.setSeconds(seconds)

for(i=1; i<=10; i++)
{
Sec.getSeconds() "<br />";
}


// Stop hiding -->
</script>

[sadated_peon]

Originally Posted by Ice(v)an

Anyone here with knowledge of JavaScript.

3) Set a value to the current seconds (both digits) based on the rundate.
Display this value in color, increment by 1 and display the new value on a new line in a NEW color. (i.e.; use the new value to determine a new color for the new line) Repeat until 10 values have been displayed.

is this right?
Also, how do I add colors to the seconds text, and have it change each time.

<script type="text/javascript">
<!--Hide from non-JavaScript browsers

var new Sec("seconds");

function ShowSec(seconds) {
document.write("Seconds as of now is:" + seconds + "<br />");

DateObject.setSeconds(seconds)

for(i=1; i<=10; i++)
{
Sec.getSeconds() "<br />";
}


// Stop hiding -->
</script>

<script type="text/javascript">

//var new Sec("seconds");

function ShowSec(seconds) {
    document.write("Seconds as of now is: " + seconds + "<br />");
}

var d = new Date();
var sec = d.getSeconds();

    for(i=0; i<10; i++)
    {
    ShowSec(sec + i) + "<br />";
    }


// Stop hiding -->
</script>

I am not sure what is meant by the color,
You could change the color by wrapping the line in a span and changing the style color.

[Ice(v)an]

I think it's meant that each of the seconds that's displayed to be in color, but in different color each time, instead of all the numbers below are like of the same color, like blue. How can I make it, that 23 is blue, for example, then 24 is white, etc.

23
24
25
26
27

Thanks this is for a friend.

[ahme]

As sadated_peon said, you can do that using span tags. And that would look something like this

<script type="text/javascript">

//var new Sec("seconds");

function ShowSec(seconds) {
    document.write("Seconds as of now is: " + seconds + "<br />");
}

function randColor(){
	var randR = Math.floor(Math.random()*255);
	var randG = Math.floor(Math.random()*255);
	var randB = Math.floor(Math.random()*255);
	return "rgb("+randR+","+randG+","+randB+")";
}

var d = new Date();
var sec = d.getSeconds();
    for(i=0; i<10; i++)
    {
		document.write("<span style='color:"+randColor()+";'>");
		ShowSec(sec + i) + "<br />";
		document.write("</span>");
    }


// Stop hiding -->
</script>

This makes each printed line printed in a random color

[Ice(v)an]

Last one for Javascript.

Display all the dates of the cu rrent week, starting with the rundate and wrapping around to "yesterday" (the day before th e rundate). Display them all in the same color, except Sunday which is always in red.

[ahme]

Originally Posted by Ice(v)an

Last one for Javascript.

Display all the dates of the cu rrent week, starting with the rundate and wrapping around to "yesterday" (the day before th e rundate). Display them all in the same color, except Sunday which is always in red.

This is what I have. And let me just warn you that I have NOT tested the script for various cases. And I'm not sure about the wrapping thing.

<script type="text/javascript">
//var new Date("month day, year);
function showDate(month, day, year) {
    document.write((month+1) + "/" + day + "/" + year + "<br />");
}

var curdate = new Date();
tday = curdate.getDate();
tmonth= curdate.getMonth();
tyear= curdate.getFullYear();
var millS = Date.UTC(tyear,tmonth,tday);
var milliseconds = 86400000;


for(var i=0;i<7;i++)
{
    millS += milliseconds;
    curdate.setTime(millS);
    tday = curdate.getDate();
    tmonth= curdate.getMonth();
    tyear= curdate.getFullYear();

    if((curdate.getDay())%7 == 0){
        document.write("<span style='color:#ff0000;'>");
        showDate(tmonth,tday,tyear);
        document.write("</span>");
    }
    else
        showDate(tmonth,tday,tyear);
}
curdate.setTime(millS-7*milliseconds);
tday = curdate.getDate();
tmonth= curdate.getMonth();
tyear= curdate.getFullYear();
showDate(tmonth,tday,tyear);
// -->
</script>

[Bruc3 Wayn3]

I think the wrapping thing just means it comes to the day before as in the name of the days of the week. For example if today is tuesday then the last day of the current week would be monday (which is yesterday as in the name of the day not the actual date).

4/22/2008 (tues)
4/23/2008
4/24/2008
4/25/2008
4/26/2008
4/27/2008 (sun) <---- red
4/28/2008 (Mon)

[Ice(v)an]

Making a webpage that has
a FORM that is emailed to YOU when the "submit" button is clicked.

[sadated_peon]

Originally Posted by Ice(v)an

Making a webpage that has
a FORM that is emailed to YOU when the "submit" button is clicked.

Using what mailer?

[Ice(v)an]

WingZero8587@hotmail.com

[sadated_peon]

Originally Posted by Ice(v)an

WingZero8587@hotmail.com

no, no, no.

What application do you need to use to send out the mail?
It changes depending on the type server the page is hosted on.

[Azn]

Can anyone interpret the meaning of, "victorious defeat"?
To give a little background, it was said by Dudley Malone, one of the defense lawyers in the Scopes Trial.

[MuKen]

Originally Posted by sadated_peon

no, no, no.

What application do you need to use to send out the mail?
It changes depending on the type server the page is hosted on.

I doubt they expect him to write a server-based method, they probably just want

<form action="mailto:WingZero8587@hotmail.com">
<input type=text name=message>
<input type=submit>

</form>

[Danny]

Originally Posted by Azn

Can anyone interpret the meaning of, "victorious defeat"?
To give a little background, it was said by Dudley Malone, one of the defense lawyers in the Scopes Trial.

well John Scopes was found guilty in 9 minutes of deliberation haha.

even though he lost the case and was found guilty, it was a turn around point in the separation of church and public education. i mean he might have lost the battle but won the war


edit//

haha i almost forgot why i even came to this thread in the first place

any history buffs?

im trying to formulate a counter-thesis for the eventual failure of reconstruction. it's been a bitch lately to find any historiography for any pro-reconstruction sentiments. seems like everyone agrees it was doomed from the start....

[kai0x]

Anyone have a biology book handy? I know this is probably simple but I think I was absent when the teacher went over this. Really need help x.x

1. What protein would be coded for by the following mRNA? (Use genetic code table)

5' - AUGCCUCAUAUGCGCCAUUAUAAGUGACACACA - 3'

2. Suppose the following DNA sequence was mutated from AGAGAGAGAGAGAGAGAG to AGAAGAGAGATCGAGAGA. What amino acid sequence will be generated in the mutated DNA?

For the first one I think I just abbreviate each protein it makes until I get to the stop codon, but I'm not entirely sure. As for the second, not sure what its asking

[Insin]

Originally Posted by kai0x

Anyone have a biology book handy? I know this is probably simple but I think I was absent when the teacher went over this. Really need help x.x

1. What protein would be coded for by the following mRNA? (Use genetic code table)

5' - AUGCCUCAUAUGCGCCAUUAUAAGUGACACACA - 3'

5'-Met-Pro-His-Met-Arg-His-Tyr-Lys-Stop-3'

2.

Suppose the following DNA sequence was mutated from AGAGAGAGAGAGAGAGAG to AGAAGAGAGATCGAGAGA. What amino acid sequence will be generated in the mutated DNA?

For the first one I think I just abbreviate each protein it makes until I get to the stop codon, but I'm not entirely sure. As for the second, not sure what its asking

DNA sequence, does it say if it's the coding strand? Or the template. I'm going to assume it's the coding strand. Also, does it tell you the polarity? Which end is 5' etc.

RNA sequence for the mutated strand would be (assuming its coding and reads left to right)

AGAAGAGAGAUCGAGAGA

Arg-Arg-Glu-lle-Glu-Arg

However, if that's the template strand than obviously the mRNA will be different.

[kai0x]

You rock. Ok so I have a few little followup questions. In the first question the codon UGA is a stop codon, so it appears you just stop once you reach that and disregard the codons after it?

For the second that was the whole question. Whats a template and coding strand exactly and how would the RNA differ?

And bonus question:

Sandra discovered a tRNA with a mutation in DNA that encodes for the anticodon UAA instead of AUU. In cells with the mutated tRNA, what will the effect be on protein synthesis. (Show work)

I'm completely unsure if this question refers to any previous codons, its confusing.

[Insin]

Originally Posted by kai0x

You rock. Ok so I have a few little followup questions. In the first question the codon UGA is a stop codon, so it appears you just stop once you reach that and disregard the codons after it?

Yeah I believe so. Stop codons are terminators, which indicate the end of a protein molecule. Think of it like a period or punctuation mark.

For the second that was the whole question. Whats a template and coding strand exactly and how would the RNA differ?

Strap yourself in.

DNA as you know, is composed of two antiparallel strands. During Transcription, only ONE strand directs the synthesis of mRNA. That is because the different strands code for different genes.

So yoy have two strands. Here is an example. I have designated which strands are which.

3' - CTT GGC GTT TTC GGA - 5' (Template)
5' - GAA CCG CAA AAG CCT - 3' (Coding)

During Transcription (which in my example will proceed left to right), the Template Strand is used as the template for RNA synthesis. Remember, Transcription ALWAYS goes from 5' to 3'.

Look at the Template strand, it starts with a 3' end. RNA polymerase attaches to the 3' end, and TRANSCIBES the mRNA 5' to 3'. That is critically important to remember.

Remember, when things base pair, A's pair with T's, and G's pair with C's. Except, in mRNA it is going to be U instead of T.

Summary: Think of it like this
The template strand is going to have the opposite pairs from the mRNA transcibed.
The coding strand is going to be essentially identical to the mRNA, except with U's instead of T's.

Got it?

And bonus question:

Sandra discovered a tRNA with a mutation in DNA that encodes for the anticodon UAA instead of AUU. In cells with the mutated tRNA, what will the effect be on protein synthesis. (Show work)

I'm completely unsure if this question refers to any previous codons, its confusing.

This question is much harder.

A sequence of 3 bases is a codon. For example, AUG is a codon, specifically Met (Start Codon).

tRNA has anticodons, which are opposite base pairs from the codons. The anticodon for AUG would be UAC for example.

Anticodons pair with codons during the translation process, it helps form the proteins.

If there is a problem with the DNA that encodes for the anticodon AUU, than the codon UAA won't have an anticodon to pair with it, because all the AUU's anticodons will be UAA.

The Codon UAA encodes for a Stop codon. Without the Anticodon, the ribosome probably won't be able to read the stop codon, so the finished protein will have problems releasing from the P site.